Composite

Part:BBa_K4687045

Designed by: Zhimin Zhan   Group: iGEM23_HBUT-China   (2023-10-07)


MAD7+recE/T+pJYS1+PlacM:MADE/TJlacM-g5d4

The exonuclease–recombinase pair recE/T can improve dsDNA recombination efficiency in C. glutamicum. In this study, we combined the recE/T and CRISPR-MAD7 systems.Using this system, we optimized the CRISPR-MAD7 promoter sequence and screened for more efficient vector backbone and PAM recognition sites, and designed donor DNA to achieve targeted gene knockout in Corynebacterium glutamicum.


Introduction

Lycopene, a potent antioxidant terpenoid, is extensively utilized in medicine, food, and cosmetics [1]. Microbial cells, such as Corynebacterium glutamicum, can naturally produce lycopene. To enhance yields, various gene editing tools are employed in constructing high-yielding strains. These tools include counter-marker-assisted allelic exchange methods like the use of levansucrase gene SacB, streptomycin-sensitive gene rspl, 5-fluorouracil-lethal gene upp, and the Cre-loxP system [2][3].

The existing strategies face challenges due to prolonged processes and inefficiencies, leading to a significant 20%-40% false positive rate. Over the past few years, CRISPR/Cas systems have emerged as cutting-edge genome manipulation technologies across diverse organisms [4]. While CRISPR-Cas9 and CRISPR-Cpf1 systems have demonstrated high efficiency in gene editing, our contribution involves the development of a novel CRISPR-MAD7 system. This system exhibits enhanced gene deletion capabilities, particularly excelling in fragment deletion.

In the present study, MAD7 was expressed under PlacM promoter in pJYS1 plasmid. The gRNA of target gene was expressed under J23119 promoter in the same pJYS1 plasmid that containing MAD7 expression cassette. Collectively, by fusing multiple parts like MAD7, promoter, terminator and donors, etc., the final part BBa_K4687045 was constructed.

045-f1.png
Figure 1. Construct design of BBa_K4687045


Experimental method

To delete two genes simultaneously, two sgRNAs were designed. MAD7, guided by the sgRNAs, can cleave the target sites of genes and achieve the goal of deleting two genes at one time. Figure 2 illustrated the process of deleting two genes.

045-f2.png
Figure 2. The process of double genes deleting via CRISPR-MAD7 (Cas12a) system (part BBa_K4687045)


Identification of function

With part BBa_K4687045, genes such as crtEb and crtR which inhibited lycopene production in Corynebacterium glutamicum ATCC13032 were deleted. The knock-out can be tested by PCR (see Figure 1) and color change (see Table1).

Compared with the PCR bands (3171 bp and 3048 bp) from wild type strain Corynebacterium glutamicum ATCC 13032, the PCR bands (2460 bp and 2307) from double deleted strain ΔcrtEbΔcrtR were shorter. Figure 3 showed the PCR results (Eb represented crtEb gene, R represented crtR gene).

045-f3.png
M: DL5000Marker; 1-7: Colony PCR bands from double deleting strain; Eb represented ''crtEb'' gene, R represented ''crtR'' gene; WT represented wild type strain
Figure 3. Agarose gel electrophoresis validation of Pof double deleting strain


Meanwhile, we investigated the color change of the double deleted strain ΔcrtEbΔcrtR. Due to accumulation of lycopene, ΔcrtEbΔcrtR showed obvious red color (figure 4), indicating a higher production of lycopene.

Table 1 The color and lycopene production of deleting crtEb and crtR genes

Deleted genes sgRNA Color
/ / Yellow
crtEb/crtR agtgattgcttattcagcacc /cccggcatctgtaacaaagac Red

045-f4.png
Figure 4. The color of wild strain and ΔcrtEbΔcrtR strain


Application of CRISPR-MAD7 for lycopene production

Through cultivation in 250 mL flasks, lycopene was produced with a higher level. In the table 2 and figure 5, the lycopene titer in ΔcrtEbΔcrtR was 19.42 folds of that in wild strain.

Table 2 The production of lycopene

Deleted genes Lycopene production (mg/L) Improvement
/ 0.40 /
crtEb/crtR 7.76 19.42 folds

045-f5.jpg
Figure 5. The color of ΔcrtEbΔcrtR cultured in flasks


Reference

  1. ↑ Story, E. N., Kopec, R. E., Schwartz, S. J., & Harris, G. K. (2010). An update on the health effects of tomato lycopene. Annual review of food science and technology, 1, 189-210.
  2. ↑ WANG Q, ZHANG J, AL MAKISHAH N H, et al. 2021. Advances and Perspectives for Genome Editing Tools of Corynebacterium glutamicum. Front Microbiol [J], 12: 654058.
  3. ↑ HUANG Y, LI L, XIE S, et al. 2017. Recombineering using RecET in Corynebacterium glutamicum ATCC14067 via a self-excisable cassette. Sci Rep [J], 7: 7916.
  4. ↑ LIU J, WANG Y, LU Y, et al. 2017. Development of a CRISPR/Cas9 genome editing toolbox for Corynebacterium glutamicum. Microb Cell Fact [J], 16: 205.


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 7380
    Illegal EcoRI site found at 13840
    Illegal EcoRI site found at 14083
    Illegal EcoRI site found at 14959
    Illegal XbaI site found at 13057
    Illegal SpeI site found at 3930
    Illegal SpeI site found at 4096
    Illegal SpeI site found at 10823
    Illegal SpeI site found at 18777
    Illegal SpeI site found at 19156
    Illegal PstI site found at 6884
    Illegal PstI site found at 12013
    Illegal PstI site found at 13303
    Illegal PstI site found at 13570
    Illegal PstI site found at 14764
    Illegal PstI site found at 16933
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 7380
    Illegal EcoRI site found at 13840
    Illegal EcoRI site found at 14083
    Illegal EcoRI site found at 14959
    Illegal NheI site found at 3907
    Illegal NheI site found at 4073
    Illegal NheI site found at 6497
    Illegal SpeI site found at 3930
    Illegal SpeI site found at 4096
    Illegal SpeI site found at 10823
    Illegal SpeI site found at 18777
    Illegal SpeI site found at 19156
    Illegal PstI site found at 6884
    Illegal PstI site found at 12013
    Illegal PstI site found at 13303
    Illegal PstI site found at 13570
    Illegal PstI site found at 14764
    Illegal PstI site found at 16933
    Illegal NotI site found at 14170
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 7380
    Illegal EcoRI site found at 13840
    Illegal EcoRI site found at 14083
    Illegal EcoRI site found at 14959
    Illegal BglII site found at 714
    Illegal BglII site found at 762
    Illegal BglII site found at 1083
    Illegal BglII site found at 2298
    Illegal BglII site found at 2950
    Illegal BglII site found at 3804
    Illegal BglII site found at 12866
    Illegal XhoI site found at 6198
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 7380
    Illegal EcoRI site found at 13840
    Illegal EcoRI site found at 14083
    Illegal EcoRI site found at 14959
    Illegal XbaI site found at 13057
    Illegal SpeI site found at 3930
    Illegal SpeI site found at 4096
    Illegal SpeI site found at 10823
    Illegal SpeI site found at 18777
    Illegal SpeI site found at 19156
    Illegal PstI site found at 6884
    Illegal PstI site found at 12013
    Illegal PstI site found at 13303
    Illegal PstI site found at 13570
    Illegal PstI site found at 14764
    Illegal PstI site found at 16933
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 7380
    Illegal EcoRI site found at 13840
    Illegal EcoRI site found at 14083
    Illegal EcoRI site found at 14959
    Illegal XbaI site found at 13057
    Illegal SpeI site found at 3930
    Illegal SpeI site found at 4096
    Illegal SpeI site found at 10823
    Illegal SpeI site found at 18777
    Illegal SpeI site found at 19156
    Illegal PstI site found at 6884
    Illegal PstI site found at 12013
    Illegal PstI site found at 13303
    Illegal PstI site found at 13570
    Illegal PstI site found at 14764
    Illegal PstI site found at 16933
    Illegal NgoMIV site found at 7795
    Illegal NgoMIV site found at 9493
    Illegal NgoMIV site found at 17471
    Illegal AgeI site found at 1865
    Illegal AgeI site found at 6124
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
Parameters
None